Struktur DNA asam deoksiribonukleat

Artikel ini akan mengeksplorasi perlombaan untuk menemukan struktur molekul DNA, bagian-bagian dari struktur dan bagaimana mereka cocok bersama, dan bagaimana pengetahuan ini telah digunakan untuk memajukan umat manusia. Apakah Anda tahu bahwa Anda berbagi banyak kesamaan dengan monyet, lalat buah, burung unta, hiu putih besar, dan bahkan cacing dan bakteri?

Pada pandangan pertama itu mungkin tidak muncul seolah-olah makhluk ini memiliki kesamaan apa pun. Namun, jika Anda memeriksa komponen molekul mereka, Anda akan melihat bahwa semua organisme ini sebenarnya sepupu jauh dari satu sama lain. Selama tahun 1950an, sebuah ledakan besar penelitian biologi terjadi, dan metode ekspresi gen tersebut telah ditetapkan. Pengetahuan yang dihasilkan selama periode ini membantu menjelaskan bagaimana gen berfungsi, dan itu memunculkan ilmu genetika molekuler.

Ilmu ini didasarkan pada aktivitas asam deoksiribonukleat (DNA) dan bagaimana kegiatan ini membawa produksi protein dalam sel. Materi genetik dikemas menjadi molekul DNA. Molekul DNA menyampaikan informasi yang diwariskan kepada messenger RNA (mRNA) yang, pada gilirannya, kode untuk protein. Ini garis komando yang direpresentasikan sebagai: DNA→mRNA→protein

Aliran informasi dari DNA untuk protein dikenal sebagai Dogma Sentral biologi molekuler.

Pada tahun 1953, dua ahli biokimia, James D. Watson dan Francis HC Crick, mengusulkan sebuah model untuk struktur DNA. (Pada tahun 1962, mereka berbagi Hadiah Nobel untuk pekerjaan mereka.) Publikasi struktur DNA membuka dunia baru genetika molekular. Strukturnya memberikan wawasan berharga tentang bagaimana gen beroperasi dan bagaimana DNA dapat memperbanyak dirinya selama mitosis, sehingga menyampaikan karakteristik keturunan. Tidak hanya penelitian baru mengungkap banyak prinsip sintesis protein, tetapi juga memunculkan ilmu bioteknologi dan rekayasa genetika.

Struktur DNA

Seperti yang diusulkan oleh Watson dan Crick, asam deoksiribonukleat (DNA) terdiri dari dua rantai nukleotida panjang. Dua rantai nukleotida memutar sekitar satu sama lain untuk membentuk sebuah helix ganda, bentuk menyerupai tangga spiral. Ikatan kimia lemah antara rantai memegang dua rantai nukleotida satu sama lain.?

Helix ganda tampak seperti tangga yang telah dipelintir di kedua ujungnya. Ini terbuat dari tiga bagian komponen, gula, gugus fosfat, dan basa nitrogen. Gula yang membentuk tulang punggung dari molekul DNA disebut deoksiribosa. Ini adalah gula 5-karbon yang diselingi dengan gugus fosfat, membentuk pola yang berulang. Sebuah kelompok fosfat adalah kelompok fungsional (suatu senyawa yang memberikan rantai karbon atau cincin fungsi tertentu) terdiri dari fosfor yang melekat pada empat molekul oksigen.

Ini basa nitrogen adalah senyawa nitrogen dan bantalan yang ditemukan dalam molekul DNA yang disebut adenin, guanin, timin, dan sitosin (A, G, T, dan C untuk pendek). Adenin dan guanin disebut purin karena mereka memiliki cincin karbon ganda. Sitosin dan timin disebut pirimidin dan memiliki cincin karbon tunggal (lihat Gambar 1). Ketika dikombinasikan, masing-masing tiga bagian membuat struktur yang disebut nukleotida, yang merupakan monomer, atau bagian komponen, dari semua asam nukleat. Gula dan fosfat kelompok membentuk ‘tulang punggung’ dari tangga dan ‘anak tangga’ adalah di mana basa nitrogen berada.

Sebelum penemuan struktur molekul DNA Watson dan Crick, ilmuwan lain bernama Erwin Chargraff menetapkan bahwa jumlah adenin sama dengan jumlah timin dan jumlah sitosin sama dengan jumlah guanin. Disebut aturan Chargraff itu, hubungan ini memungkinkan untuk apa yang disebut pasangan basa komplementer. Karena bentuk dari masing-masing basa nitrogen ini, adenin hanya dapat dipasangkan dengan timin dan sitosin hanya dapat dipasangkan dengan guanin.

Untuk menunjukkan aturan Chargraff itu, mempertimbangkan mengikuti urutan acak basa nitrogen dari untai DNA:

Loading...

TTATGGCCGATATATAACCG

Karena adenin memiliki ikatan dengan timin dan sitosin memiliki ikatan dengan guanin, untai komplementer, atau bagian lain dari sepotong DNA akan menjadi:

AATACCGGCTATATATTGGC

Gambar 2 menunjukkan struktur tangga memutar dari helix ganda dan bagaimana basa nitrogen sejajar dengan satu sama lain. Kelompok-kelompok fosfat menghubungkan molekul deoksiribosa bersama-sama dan untaian diadakan bersama-sama dengan ikatan hidrogen. Perhatikan bahwa untai berjalan dalam arah yang berlawanan. Salah satu ujung dari setiap helai disebut 3 ‘(Prime tiga) akhir dan ujung lainnya disebut 5’ (Prime lima). Hal ini penting untuk dipertimbangkan saat salinan DNA itu sendiri selama pembelahan sel.

Sebuah nukleotida dalam rantai DNA terdiri dari tiga bagian: basa nitrogen, gugus fosfat, dan molekul deoksiribosa. Basa nitrogen dari masing-masing rantai nukleotida terdiri dari dua jenis utama: purin dan pirimidin. Basa purin memiliki dua cincin menyatu karbon dan nitrogen atom, sedangkan pirimidin hanya memiliki satu cincin. Kedua basa purin dalam DNA adalah adenin (A) dan guanin (G). Para basa pirimidin pada DNA adalah sitosin (C) dan timin (T). Purin dan basa pirimidin ditemukan di kedua untai double helix.

asam deoksiribonukleat
asam deoksiribonukleat

Kelompok fosfat DNA berasal dari molekul asam fosfat. Kelompok fosfat menghubungkan molekul deoksiribosa satu sama lain dalam rantai nukleotida. Deoksiribosa adalah karbohidrat lima karbon. Para purin dan basa pirimidin yang melekat pada molekul deoksiribosa, dan basa purin dan pirimidin yang berlawanan satu sama lain pada dua rantai nukleotida. Adenin selalu timin berhadapan dengan mengikat timin. Guanin selalu dengan sitosin berhadapan dengan mengikat sitosin. Adenin dan timin dikatakan pelengkap, seperti guanin dan sitosin ini dikenal sebagai prinsip pasangan basa komplementer.

Struktur DNA
Struktur DNA

Kode Genetik

DNA disebut sebagai molekul genetik. Gen adalah segmen DNA yang bertanggung jawab untuk karakteristik fisik dari suatu organisme. Ini berarti bahwa DNA membawa semua instruksi yang dibutuhkan untuk membuat semua gen, atau genom, dan pada gilirannya, menghasilkan semua ciri-ciri dari suatu organisme. Gen membuat sekitar dua persen dari total DNA dalam genom seseorang. Ini adalah urutan basa nitrogen yang pada akhirnya menghasilkan sifat-sifat Anda mengekspresikan, atau fenotipe Anda. Misalnya, rambut cokelat, mata biru, dan penyakit Alzheimer adalah semua ciri-ciri yang disebabkan oleh gen. Meskipun ada jutaan pasangan basa dalam DNA Anda, tidak semua dari mereka akan menunjukkan ciri-ciri. Ternyata bahwa gen-gen yang menunjukkan sifat, yang disebut ekson, diselingi dengan non-menunjukkan urutan disebut intron. Selama penciptaan protein (proses yang diperlukan untuk menunjukkan sifat-sifat Anda), intron dibuang sehingga ekson dapat diaktifkan untuk menunjukkan ciri-ciri.

Kesimpulan

DNA adalah molekul genetik makhluk hidup. Ini menyediakan cetak biru untuk semua sifat-sifat suatu organisme mengungkapkan selama masa pakainya. Sejak strukturnya ditemukan pada tahun 1953, telah ada upaya yang luar biasa untuk menyelidiki apa yang dilakukan dan bagaimana berperilaku. Pengetahuan yang diperoleh dari Proyek Genom Manusia kini telah digunakan di seluruh dunia dalam menyediakan aplikasi di bidang kedokteran, evolusi, pertanian, dan ekologi.

Loading...

Leave a Reply

Your email address will not be published. Required fields are marked *